Prev. |  KEGG KO K02961 > 

RIKEN DNA Bank Human Resource - MRPS17

Gene ID NCBI Gene 51373 |  KEGG hsa:51373
Gene Symbol MRPS17
Protein Name mitochondrial ribosomal protein S17
Synonyms HSPC011|MRP-S17|RPMS17|S17mt
Ortholog resource in our bank

  MRPS17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025642 IRAK064B18 pCMV-SPORT6 BC037405 NM_015969 Full
HGY036577 IRAK091H09 pBluescript BC047445 NM_015969 Full
HGX047913 IRAK119N01 pCMV-SPORT6 BC054031 NM_015969 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021064 W01A052K24 pENTR-TOPO IRAK091H09 BC047445 NM_015969  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR325231 RBb13B07 pKA1U5 NM_015969.2  
GATCCCGCTGCGACCGGCGCTCCCCGGGGCAGGTGGCTGCATAGTCTTGGCGGAGGTGAC
HKR370010 RBd25A10 pGCAP10 NM_015969.2  
GAGTCTCGTGGTGGAGGTGACCAAAGCCACGTAATGTCCGTAGTTCGCTCATCCGTCCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl