Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARL6IP4

Gene ID (NCBI) 51329
Gene Symbol ARL6IP4
Protein Name ADP-ribosylation-like factor 6 interacting protein 4
Synonyms SFRS20|SR-25|SRp25|SRrp37
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083322 IRAL008F02 pOTB7 BC001958 NM_016638 Partial
HGY091928 IRAL029N16 pOTB7 BC015909 NM_018694 Full
HGY093207 IRAL033A07 pOTB7 BC015569 NM_001002252 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048051 ARe20C03 pKA1U5 NM_016638.2  
TTGCTCGCCGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGG
HKR052001 ARe30A01 pKA1U5 NM_016638.2  
GCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGCCCGCGGCGCC
HKR055756 ARe39G12 pKA1U5 NM_016638.2  
GAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGGTGGGAACGGAGCAGCCCC
HKR076876 ARe92D04 pKA1U5 NM_016638.2  
GGGGCACGGGGCGGGCCCTTAACAGGCACCGCTGCGGGGACTGGAGTCGGCGGAGAAAAC
HKR077602 ARe94A02 pKA1U5 NM_016638.2  
GGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGNGGTCGAGNCC
HKR238494 ARiS096D22 pGCAP10 NM_016638.2  
GGCCGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAG
HKR323229 RBb08B05 pKA1U5 NM_016638.2  
GTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCANGGCGGTCGAGCCCGCGGCGCCATG
HKR365724 RBd14F04 pGCAP10 NM_016638.2  
GGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGCCCGCGGCGCCATGGCTCACGTCG
HKR328100 RBb20E04 pKA1U5 NM_016638.2  
GCTCCTCGCCGCCGCTTCCTCTCGAGAAGGCGCNGNTNGGGCTGTCCGGCCCGCAGGGCG
HKR371750 RBd29G06 pGCAP10 NM_016638.2  
TGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGGTGGGA
HKR378407 RBd46A07 pGCAP10 NM_016638.2  
GTGTCCGGCCCGCAGGGCGGTCGAGCCCGCGGCGCCATGGCTCACGTCGGCTCCCGCAAG
HKR379707 RBd49E11 pGCAP10 NM_016638.2  
GAAGCCTCCTCGCCGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAG
HKR340953 RBb52G09 pGCAP1 NM_016638.2  
GTTGCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGCCCGCGGC
HKR380803 RBd52A03 pGCAP10 NM_016638.2  
GGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGGTGGGAACGGAGCAGCCCCGGGGG
HKR347308 RBb68E12 pGCAP1 NM_016638.2  
GCGGCCAGCCTCCCGCGCAGCGCCCCGGCCGGAAAGCCTCCTCGCCGCCGCTTCCTCTCG
HKR386031 RBd65B07 pGCAP10 NM_016638.2  
GCTCNNNNNAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGGTGGGAACGGA
HKR403174 RBdS007P14 pGCAP10 NM_016638.2  
GGCCGCTTCCTCTCGAGAAGGCGCGGGGCGGGCTGTCCGGCCCGCAGGGCGGTCGAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl