Prev. |  KEGG KO K19367 > 

RIKEN DNA Bank Human Resource - SPG21

Gene ID NCBI Gene 51324 |  KEGG hsa:51324
Gene Symbol SPG21
Protein Name SPG21, maspardin
Synonyms ACP33|BM-019|GL010|MAST
Ortholog resources KEGG ortholog (KEGG orthology K19367) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082462 IRAL006C14 pOTB7 BC000244 NM_016630 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169348 ARi23G04 pGCAP10 NM_016630.3  
GGGCCGGCCTCCCGCACGCACCGCGCAGCCTGCTGTGCCCGTGGGTCCCGAGTGCTCCGC
HKR276438 ARiS191B14 pGCAP10 NM_016630.3  
GAGTTCTGTGATGGATTCAGAAAACTTTTAGACCATTTACAATTGGATAAAGTTCATCTT
HKR322173 RBb05H05 pKA1U5 NM_016630.3  
GCTCAGAGGCCGGCCTCCCGCACGCACCGCGCAGCCTGCTGTGCCCGTGGGTCCCGAGTG
HKR372170 RBd30H02 pGCAP10 NM_016630.3  
GGAGCGCGGCGGCCCAAGCTCGCTTGGCCACGCGCCCCGCCCCCTCAGAGGCCGGCCTCC
HKR405845 RBdS014K05 pGCAP10 NM_016630.3  
GGCCGCCCGCCCCGACCCGGGCCCAGCCGCCTCCACGGCCCGCGCTCGTACTGGAGCGAA
HKR471116 RBdS177N04 pGCAP10 NM_016630.3  
CGGCCGGCCGAGCGGCGGTCGGGCGGGGGGANNNCNNANNCCCANNCCTCNNNNGGAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl