Prev. |  KEGG KO K06974 > 

RIKEN DNA Bank Human Resource - AMZ2

Gene ID NCBI Gene 51321 |  KEGG hsa:51321
Gene Symbol AMZ2
Protein Name archaelysin family metallopeptidase 2
Synonyms -
Ortholog resource in our bank

  AMZ2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044202 IRAK110I10 pCMV-SPORT6 BC050709 NM_016627 Full/var
HGY094261 IRAL035K21 pDNR-LIB BC035935 NM_016627 Full/var
HGY099248 IRAL048B24 pDNR-LIB BC056271 NM_016627 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181369 ARi53H01 pGCAP10 NM_001033569.1  
GGGCTGCCGCGGGTGGGTGGTATCGAGGCCTGTCGGCCAGGCCCAGACATGTCCGTCCTT
HKR247361 ARiS118G17 pGCAP10 NM_001033569.1  
GGTGTGGCGCAGTGCNAANGGNCNCGGTGCGCATGCGCGTGAGGGCTGCCGCGGCCAGGC
HKR277853 ARiS194K13 pGCAP10 NM_001033569.1  
GGGGCTGCCGCGGGTGGGTGGTATCGAGGCCTGTCGGGTCAGGGCGGTTCGCGGGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl