Prev. |  KEGG KO K15113 > 

RIKEN DNA Bank Human Resource - SLC25A37

Gene ID NCBI Gene 51312 |  KEGG hsa:51312
Gene Symbol SLC25A37
Protein Name solute carrier family 25 member 37
Synonyms HT015|MFRN|MFRN1|MSC|MSCP|PRO1278|PRO1584|PRO2217
Ortholog resource in our bank

  SLC25A37

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075724 ARe89F04 pKA1U5 NM_016612.2  
TGCTCCCTGCCCACCTCCTGCAGCCTCCTGCGCCCCGCCGAGCTGGCGGATGGAGCTGCG
HKR339627 RBb49B03 pGCAP1 NM_016612.2  
ANGTCTCNACAACCACCAANNATCTAACTAAGCTTNAAAAGGCCCCTTNTNGGGGATGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl