Prev. |  KEGG KO K20029 > 

RIKEN DNA Bank Human Resource - ZDHHC3

Gene ID NCBI Gene 51304 |  KEGG hsa:51304
Gene Symbol ZDHHC3
Protein Name zinc finger DHHC-type palmitoyltransferase 3
Synonyms DHHC-3|DHHC3|GODZ|ZNF373
Ortholog resource in our bank

  ZDHHC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008348 IRAK020O12 pCMV-SPORT6 BC015467 NM_016598 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE119235 M01C098B11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119283 M01C098D11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119331 M01C098F11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119379 M01C098H11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119427 M01C098J11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119475 M01C098L11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119523 M01C098N11 pDONR221 IMS12-G06 AK127837 XM_933464  
HGE119571 M01C098P11 pDONR221 IMS12-G06 AK127837 XM_933464  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024636 W01A061J20 pENTR-TOPO IRAK020O12 BC015467 NM_016598  
HGE024638 W01A061J22 pENTR-TOPO IRAK020O12 BC015467 NM_016598  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047679 ARe19D07 pKA1U5 NM_016598.2  
ATCCTGTGGAGCCGCGGCCGCCGCCACTGCCGGGAGAGCTCGATGGGCTTCTCCTGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl