Prev. |  KEGG KO K09576 > 

RIKEN DNA Bank Human Resource - FKBP11

Gene ID NCBI Gene 51303 |  KEGG hsa:51303
Gene Symbol FKBP11
Protein Name FKBP prolyl isomerase 11
Synonyms FKBP19
Ortholog resource in our bank

  FKBP11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019972 IRAK049P12 pCMV-SPORT6 BC027973 NM_016594 Full
HGX037437 IRAK093J21 pCMV-SPORT6 BC048292 NM_016594 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276780 ARiS191P20 pGCAP10 NM_016594.1  
GCCCGTCCAGTCTGGCCTGGGCGCCGCGGGAACGCTGTCCTGGCTGCCGCCACCCGAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl