Prev. |  KEGG KO K06734 > 

RIKEN DNA Bank Human Resource - CD320

Gene ID NCBI Gene 51293 |  KEGG hsa:51293
Gene Symbol CD320
Protein Name CD320 molecule
Synonyms 8D6|8D6A|TCBLR
Ortholog resources KEGG ortholog (KEGG orthology K06734) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082124 IRAL005F04 pOTB7 BC000668 NM_016579 Full
HGY088657 IRAL021K17 pDNR-LIB BC007083 NM_016579 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170547 ARi26G03 pGCAP10 NM_016579.2  
GACCCCGCGCGTGCGCGTGCGCAGGGATAAGAGAGCGGTCTGGACAGCGCGTGGCCGGCG
HKR328098 RBb20E02 pKA1U5 NM_016579.2  
GGCCGCTGTGGGGACAGCATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGGCGAACA
HKR399349 RBd98G05 pGCAP10 NM_016579.2  
TGGGCGCCGCTGTGGGGACAGCATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl