Prev. |  KEGG KO K00364 > 

RIKEN DNA Bank Human Resource - GMPR2

Gene ID NCBI Gene 51292 |  KEGG hsa:51292
Gene Symbol GMPR2
Protein Name guanosine monophosphate reductase 2
Synonyms GMPR 2
Ortholog resource in our bank

  GMPR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083526 IRAL008N14 pOTB7 BC003053 NM_016576 Full/var
HGY089450 IRAL023K10 pOTB7 BC008021 NM_016576 Full
HGY090274 IRAL025L10 pOTB7 BC009832 NM_001002002 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR249013 ARiS122I21 pGCAP10 NM_001002000.1  
GATTGCTCTTTGCAGGGGTAGAAGAAGGAAGTGTAGCGGGGTAAGGAATGTACCGTCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl