Prev. |  KEGG KO K18177 > 

RIKEN DNA Bank Human Resource - COA4

Gene ID NCBI Gene 51287 |  KEGG hsa:51287
Gene Symbol COA4
Protein Name cytochrome c oxidase assembly factor 4 homolog
Synonyms CHCHD8|CMC3|E2IG2
Ortholog resources KEGG ortholog (KEGG orthology K18177) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054902 ARe37E06 pKA1U5 NM_016565.2  
GGAAAGGATGTACAGAGGATCCCCAACCGCCTGCGAAACCCAAGCCGCCGCGTAGGAGCG
HKR172010 ARi30A10 pGCAP10 NM_016565.2  
GGCTCCCCACTAGGGGCTGGTTCCTGANAGGATGTACAGAGGATCCCCAACCGNCTGCGA
HKR327324 RBb18F04 pKA1U5 NM_016565.2  
GGAAACCCAAGCCGCCGCGTAGGAGCGTGCGTTCGGGCCCTCTTCTCCCACCTGTTCGGT
HKR371275 RBd28D03 pGCAP10 NM_016565.2  
GACAGAGGATCCCCAACCGCCTGCGAAACCCAAGCCGCCGCGTAGGAGCGTGCGTTCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl