Prev. | 

RIKEN DNA Bank Human Resource - SCAND1

Gene ID NCBI Gene 51282 |  KEGG hsa:51282
Gene Symbol SCAND1
Protein Name SCAN domain containing 1
Synonyms RAZ1|SDP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082924 IRAL007F04 pOTB7 BC000785 NM_033630 Full
HGY092266 IRAL030L02 pOTB7 BC036709 NM_033630 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000523 W01A001F03 pENTR-TOPO IRAL007F04 BC000785 NM_033630  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068976 ARe72H08 pKA1U5 NM_016558.2  
GACTTTCGCTTCCGGCTGCCGCAGGCGCTTCGCTGGTGCAGACGCAGTGCTGAGCACACA
HKR168924 ARi22F04 pGCAP10 NM_016558.2  
GGCTCGCGCGCCGACCTGGACGCAGAGAAGCCAGAGACTTTCGCTTCCGGCTGCCGCAGG
HKR174505 ARi36E09 pGCAP10 NM_016558.2  
GCGCAGGCGCTTCGCTGGTGCAGGTAAGCTCCGCACACTCTCGGCCGGTCCCGAGTCCGA
HKR385653 RBd64C05 pGCAP10 NM_016558.2  
GGCGCGCCGACCTGGACGCAGAGAAGCCAGAGACTTTCGCTTCCGGCTGCCGCAGGCGCT
HKR452906 RBdS132E10 pGCAP10 NM_016558.2  
GGCTTCCGGCTGCCGCAGGCGCTTCGCTGGTGCAGGTAAGCTCCGCACACTCTCGGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl