Prev. | 

RIKEN DNA Bank Human Resource - MAPKAPK5-AS1

Gene ID NCBI Gene 51275 |  KEGG hsa:51275
Gene Symbol MAPKAPK5-AS1
Protein Name MAPKAPK5 antisense RNA 1
Synonyms C12orf47
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090442 IRAL026B18 pOTB7 BC023547 NM_016534 Partial
HGY090497 IRAL026E01 pOTB7 BC007973 NM_016534 Partial/var
HGY093218 IRAL033A18 pOTB7 BC015633 NM_016534 Partial/var
HGY103130 IRAL057N18 pDNR-LIB BC071748 NR_152608.1

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378924 RBd47F04 pGCAP10 XR_017874.1  
GACTCTGCGGAGATTCACGCCTGGAAAACGCTCTTCTGAGAGGATCTGTGGAGGTCAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl