Prev. |  KEGG KO K08504 > 

RIKEN DNA Bank Human Resource - BET1L

Gene ID NCBI Gene 51272 |  KEGG hsa:51272
Gene Symbol BET1L
Protein Name Bet1 golgi vesicular membrane trafficking protein like
Synonyms BET1L1|GOLIM3|GS15|HSPC197
Ortholog resource in our bank

  BET1L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027351 IRAK068G07 pCMV-SPORT6 BC032779 NM_016526
HGY081401 IRAL003I09 pOTB7 BC008971 NM_016526 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365636 RBd14B12 pGCAP10 NM_016526.4  
GGACTGCGCCACGTCTGAGGCGGCTGTGGCCACGTCTGAGGCGGCTGTGGCCGCGTCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl