Prev. |  KEGG KO K02907 > 

RIKEN DNA Bank Human Resource - MRPL30

Gene ID NCBI Gene 51263 |  KEGG hsa:51263
Gene Symbol MRPL30
Protein Name mitochondrial ribosomal protein L30
Synonyms L28MT|L30MT|MRP-L28|MRP-L30|MRPL28|MRPL28M|RPML28
Ortholog resource in our bank

  MRPL30

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082844 IRAL007B20 pOTB7 BC000217 NM_145212.4
HGY094547 IRAL036G03 pDNR-LIB BC022391 NM_145213 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081636 M01C004B12 pDONR221 04-134-2_2-H06 AK025547 NM_145213  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264673 ARiS161L09 pGCAP10 NM_145212.2  
GCCTTCGGAGGAAAATTTCAGGCTGAAGGTTTAGCGGGTGCCGCCTCTAAAGAGAGCAAT
HKR370828 RBd27B04 pGCAP10 NM_145212.2  
GTTCCTCTGCTCTGCTTCCCTTCGGAGGAAAATTTCAGGCTGAAGGTTTAGCGGGTGCCG
HKR416198 RBdS040I06 pGCAP10 NM_145212.2  
TGGTAGTTCTTCCTCTGCTCTGCTTCCCTTCGGAGGAAAATTTCAGGCTGAAGGTTTAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl