Prev. | 

RIKEN DNA Bank Human Resource - PBDC1

Gene ID NCBI Gene 51260 |  KEGG hsa:51260
Gene Symbol PBDC1
Protein Name polysaccharide biosynthesis domain containing 1
Synonyms CXorf26
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044361 IRAK110P01 pCMV-SPORT6 BC051894 NM_016500 Full
HGY083445 IRAL008K05 pOTB7 BC001220 NM_016500

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169605 ARi24A05 pGCAP10 NM_016500.3  
GAGGGAGAGCGCACGGTGGAGCCGCCAGTTGAGAAGGACTCTGNTCCGGCTCAGCTTTCC
HKR327330 RBb18F10 pKA1U5 NM_016500.3  
GGGGGCCAGCAACTTCCTCAGCTGGAGGGAGAGCGCACGGTGGAGCCGCCAGTTGAGAAG
HKR368947 RBd22G03 pGCAP10 NM_016500.3  
GGCCAGTTGAGAAGGACTCTGATCCGGCTCAGCTTTCCAATCAGCTGCGGAAGGAGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl