Prev. |  KEGG KO K19385 > 

RIKEN DNA Bank Human Resource - TMEM216

Gene ID NCBI Gene 51259 |  KEGG hsa:51259
Gene Symbol TMEM216
Protein Name transmembrane protein 216
Synonyms HSPC244
Ortholog resource in our bank

  TMEM216

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087911 IRAL019M23 pDNR-LIB BC011010 NM_016499 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR077298 ARe93E02 pKA1U5 NM_016499.3  
GGCCACGGGGACTGAAGATGGCGCCGCGAGGTAAACGGTTGTCCTCCACCCCGCTGGAAA
HKR079356 ARe98G12 pKA1U5 NM_016499.3  
AGGCTGCCACGGGGACTGAAGATGGCGCCGCGAGGTAAACGGTTGTCCTCCACCCCGCTG
HKR405538 RBdS013O02 pGCAP10 NM_016499.3  
GAGCGTATGCTGCCACGGGGACTGAAGATGGCGCCGCGAGCGTTAGGGACGTCGCGCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl