Prev. |  KEGG KO K01081 > 

RIKEN DNA Bank Human Resource - NT5C3A

Gene ID NCBI Gene 51251 |  KEGG hsa:51251
Gene Symbol NT5C3A
Protein Name 5'-nucleotidase, cytosolic IIIA
Synonyms NT5C3|P5'N-1|P5N-1|PN-I|POMP|PSN1|UMPH|UMPH1|cN-III|hUMP1|p36
Ortholog resource in our bank

  NT5C3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066446 IRAK166B22 pCMV-SPORT6 BC071652 NM_001002010 Full
HGY067060 IRAK167K20 pBluescriptR BC066914 NM_016489 Full
HGY084589 IRAL011H21 pOTB7 BC013292 NM_016489 Partial/var
HGY095375 IRAL038H07 pDNR-LIB BC015856 NM_016489 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330170 RBb25H02 pGCAP1 NM_001002010.1  
GCTCTCCCATCGATGGCGTGTGGGTGGGGCTTCGTGGGGGCGAAGCTGCGCGGGGCGGGG
HKR348551 RBb71G07 pGCAP1 NM_001002010.1  
GGATCCCGCGCTTCCGAGACTCGCAGTCTACGCGAGCTGCCTGTTTTTTTCCTGCTTGGA
HKR365281 RBd13D09 pGCAP10 NM_001002010.1  
GGGCGTCGCTGCGCGGGGCGGGGCGTCGCGNGCTCGTCCGTGATGCTCTGGGATCCCGCG
HKR385755 RBd64G11 pGCAP10 NM_001002010.1  
GAGTCTACGCGAGCTGCCTGTTTTTTTCCTGCTTGGACGCGCATGAGGGCCCCGTCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl