Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NT5C3A

Gene ID (NCBI) 51251
Gene Symbol NT5C3A
Protein Name 5'-nucleotidase, cytosolic IIIA
Synonyms NT5C3|P5'N-1|P5N-1|PN-I|POMP|PSN1|UMPH|UMPH1|cN-III|hUMP1|p36
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01081)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX066446 IRAK166B22 pCMV-SPORT6 BC071652 NM_001002010 Full
HGY067060 IRAK167K20 pBluescriptR BC066914 NM_016489 Full
HGY084589 IRAL011H21 pOTB7 BC013292 NM_016489 Partial/var
HGY095375 IRAL038H07 pDNR-LIB BC015856 NM_016489 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR365281 RBd13D09 pGCAP10 NM_001002010.1  
GGGCGTCGCTGCGCGGGGCGGGGCGTCGCGNGCTCGTCCGTGATGCTCTGGGATCCCGCG
HKR330170 RBb25H02 pGCAP1 NM_001002010.1  
GCTCTCCCATCGATGGCGTGTGGGTGGGGCTTCGTGGGGGCGAAGCTGCGCGGGGCGGGG
HKR385755 RBd64G11 pGCAP10 NM_001002010.1  
GAGTCTACGCGAGCTGCCTGTTTTTTTCCTGCTTGGACGCGCATGAGGGCCCCGTCCATG
HKR348551 RBb71G07 pGCAP1 NM_001002010.1  
GGATCCCGCGCTTCCGAGACTCGCAGTCTACGCGAGCTGCCTGTTTTTTTCCTGCTTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl