Prev. | 

RIKEN DNA Bank Human Resource - TMEM69

Gene ID NCBI Gene 51249 |  KEGG hsa:51249
Gene Symbol TMEM69
Protein Name transmembrane protein 69
Synonyms C1orf154
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028489 IRAK071D17 pBluescriptR BC040289 NM_016486 Full/var
HGY096590 IRAL041H22 pDNR-LIB BC034147 NM_016486 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370808 RBd27A08 pGCAP10 NM_016486.3  
TGGGAAGTGCCTTTCCAGTGGACCTGGGCTGTTGTTGCGGTTGTTTTCCTTCTCTCCGTG
HKR371678 RBd29D06 pGCAP10 NM_016486.3  
GACTTGCCGGAAGTGCCTTTCCAGTGGACCTGGGCTGTTGTTGCGGTTGTTTTCCTTCTC
HKR416009 RBdS040A09 pGCAP10 NM_016486.3  
GAGGGGCCTCTCTGAATCCACTTGCCGGAAGTGCCTTTCCAGTGGACCTGGGCTGTTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl