Prev. |  KEGG KO K10135 > 

RIKEN DNA Bank Human Resource - SHISA5

Gene ID NCBI Gene 51246 |  KEGG hsa:51246
Gene Symbol SHISA5
Protein Name shisa family member 5
Synonyms SCOTIN
Ortholog resource in our bank

  SHISA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05521 pKM2L-phSCT Promoter Bank clone, Human scotin promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081821 IRAL004J05 pOTB7 BC001463 NM_016479 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005146 W01A012O10 pENTR-TOPO flj0027h07 AK075441 NM_016479  
HGE005148 W01A012O12 pENTR-TOPO flj0027h07 AK075441 NM_016479  
HGE005150 W01A012O14 pENTR-TOPO flj0027h07 AK075441 NM_016479  
HGE005152 W01A012O16 pENTR-TOPO flj0027h07 AK075441 NM_016479  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058178 ARe45H10 pKA1U5 NM_016479.3  
GGAAATTGAAACTGAGTGGCCCACGATGGGAAGAGGGGAAAGCCCAGGGGTACAGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl