Prev. | 

RIKEN DNA Bank Human Resource - CCDC174

Gene ID NCBI Gene 51244 |  KEGG hsa:51244
Gene Symbol CCDC174
Protein Name coiled-coil domain containing 174
Synonyms C3orf19|HSPC212|IHPM|IHPMR
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018483 IRAK046D11 pBluescriptR BC033897 NM_016474 Full/var
HGY086517 IRAL016E21 pDNR-LIB BC005199 NM_016474
HGY091323 IRAL028F03 pOTB7 BC013999 NM_016474 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122454 ARh06C06 pGCAP1 NM_016474.4  
GGGACGGAGGTAGGCTTACGAGGCCTGTGTCGGGTAGAAAGGGTCCTTCCTGGACCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl