Prev. |  KEGG KO K18182 > 

RIKEN DNA Bank Human Resource - COX16

Gene ID NCBI Gene 51241 |  KEGG hsa:51241
Gene Symbol COX16
Protein Name COX16, cytochrome c oxidase assembly homolog
Synonyms C14orf112|HSPC203
Ortholog resources KEGG ortholog (KEGG orthology K18182) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081549 IRAL003O13 pOTB7 BC001702 NM_016468 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235368 ARiS088G24 pGCAP10 NM_016468.4  
GGAGAGCGTGAGCTGCTGAGATTTGGGAGTCTGCGCTAGGCCCGCTTGGAGTTCTGAGCC
HKR243927 ARiS109N15 pGCAP10 NM_016468.4  
GACTAAGGACCGAGCACCAAATAACCAAGGAAAAGGAAGTGAGTTAAGGACGTACTCGTC
HKR247236 ARiS118B12 pGCAP10 NM_016468.4  
TAGGACGTACTCGTCTTGGTGAGAGCGTGAGCTGCTGAGATTTGGGAGTCTGCGCTAGGC
HKR321352 RBb03G08 pKA1U5 NM_016468.4  
GAAATAACCAAGGAAAAGGAAGTGAGTTAAGGACGTACTCGTCTTGGTGAGAGCGTGAGC
HKR367771 RBd19H03 pGCAP10 NM_016468.4  
GGTGAGCTGCTGAGATTTGGGAGTCTGCGCTAGGCCCGCTTGGAGTTCTGAGCCGATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl