Prev. | 

RIKEN DNA Bank Human Resource - GLTP

Gene ID NCBI Gene 51228 |  KEGG hsa:51228
Gene Symbol GLTP
Protein Name glycolipid transfer protein
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086228 IRAL015J12 pOTB7 BC009932 NM_016433 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098447 M01C046B23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098495 M01C046D23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098543 M01C046F23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098591 M01C046H23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098639 M01C046J23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098687 M01C046L23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098735 M01C046N23 pDONR221 MGC12-G12 BC009932 NM_016433  
HGE098783 M01C046P23 pDONR221 MGC12-G12 BC009932 NM_016433  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173778 ARi34H10 pGCAP10 NM_016433.3  
GGGGCGGTGTCGACGCTTGCGGCGCCGGTTGGTTTATCACCGCGGGCCTCGACCCCCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl