Prev. | 

RIKEN DNA Bank Human Resource - ZNF219

Gene ID NCBI Gene 51222 |  KEGG hsa:51222
Gene Symbol ZNF219
Protein Name zinc finger protein 219
Synonyms ZFP219
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019323 IRAK048F03 pBluescriptR BC036105 NM_016423 Full/var
HGY082322 IRAL005N10 pOTB7 BC000694 NM_016423 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068169 ARe70H01 pKA1U5 NM_016423.2  
ATCCTGGGTCCCCAGCTCCCTGATCCCCGGAGCCAGATTCCGGCTCCCGCGCGGCTCCCA
HKR365652 RBd14C04 pGCAP10 NM_016423.2  
GGTGTGAGGGAGCCTCTCcCCTGCAGAGAGGAGGAAaGCCTGCCTCGGAacaGCCCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl