Prev. |  KEGG KO K07390 > 

RIKEN DNA Bank Human Resource - GLRX5

Gene ID NCBI Gene 51218 |  KEGG hsa:51218
Gene Symbol GLRX5
Protein Name glutaredoxin 5
Synonyms C14orf87|FLB4739|GRX5|PR01238|PRO1238|PRSA|SIDBA3|SPAHGC
Ortholog resources KEGG ortholog (KEGG orthology K07390) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039460 IRAK098K20 pCMV-SPORT6 BC047680 NM_016417 Full
HGY088014 IRAL020A14 pOTB7 BC023528 NM_016417 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098834 M01C047B10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE098882 M01C047D10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE098930 M01C047F10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE098978 M01C047H10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE099026 M01C047J10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE099074 M01C047L10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE099122 M01C047N10 pDONR221 MGC13-D05 BC023528 NM_016417  
HGE099170 M01C047P10 pDONR221 MGC13-D05 BC023528 NM_016417  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044002 ARe10A02 pKA1U5 NM_016417.2  
GGGGCCGGGGAGCGCTCTGGGTGGCCAGCTGTGGGCCCGGGCCGTCGTGGGCTCCGGCTT
HKR324528 RBb11F08 pKA1U5 NM_016417.2  
GGTGGGCCCGGGCCGTCGTGGGCTCCGGCTTGCNTGNNAGAGATGAGCGGGTCCCTCGGC
HKR331348 RBb28G04 pGCAP1 NM_016417.2  
HKR336554 RBb41G10 pGCAP1 NM_016417.2  
GGTGGGCCCGGGCCGTCGTGGGCTCCGGCTTGCGTGCGGAGATGAGCGGGTCCCTCGGCC
HKR366076 RBd15D04 pGCAP10 NM_016417.2  
GGCCGCGGGCCGGGGAGCGCTCTGGGTGGCCAGCTGTGGGCCCGGGCCGTCGTGGGCTCC
HKR366450 RBd16C02 pGCAP10 NM_016417.2  
GGTGGGCCCGGGCCGTCGTGGGCTCCGGCTTGCGTGCGGAGATGAGCGGGTCCCTCGGCC
HKR382805 RBd57A05 pGCAP10 NM_016417.2  
NGGCCGTCGTGGGCTCCGGNTTGCGTGCGGAGATGAGCGGGTCCNTNNNCCGAGCTGCGG
HKR405254 RBdS013C06 pGCAP10 NM_016417.2  
GGGGCCGGGGAGCGCTCTGGGTGGCCAGCTGTGGGCCCGGGCCGTCGTGGGCTCCGGCTT
HKR441796 RBdS104I04 pGCAP10 NM_016417.2  
GNTGNNNCCNGNCCGTCGTGNGCTCCGGCTTGCGTGCGGAGATGAGCGGGTCCCTCGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl