Prev. | 

RIKEN DNA Bank Human Resource - NUSAP1

Gene ID NCBI Gene 51203 |  KEGG hsa:51203
Gene Symbol NUSAP1
Protein Name nucleolar and spindle associated protein 1
Synonyms ANKT|BM037|LNP|NUSAP|PRO0310p1|Q0310|SAPL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001619 IRAK004A19 pCMV-SPORT6 BC001308 NM_018454 Full
HGX001958 IRAK004O22 pCMV-SPORT6 BC010838 NM_016359 Full/var
HGX008745 IRAK021O09 pCMV-SPORT6 BC012887 NM_018454 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022333 W01A055N21 pENTR-TOPO flj0036j22 AK023483 NM_018454  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076435 ARe91B11 pKA1U5 NM_016359.3  
GAAAGTTAAGAGTGGCGCCAGGGATTTGAACCGCGCTGACGAAGTTTGGTGATCCATCTT
HKR325324 RBb13F04 pKA1U5 NM_016359.3  
HKR330126 RBb25F06 pGCAP1 NM_016359.3  
GGTGGCGCCAGGGATTTGAACCGCGCTGACGAAGTTTGGTGATCCATCTTCCGAGTATCG
HKR402952 RBdS007G08 pGCAP10 NM_016359.3  
GGGCGCCAGGGATTTGAACCGCGCTGACGAAGTTTGGTGATCCATCTTCCGAGTATCGCC
HKR408963 RBdS022G19 pGCAP10 NM_016359.3  
GGAGTATCGCCGGGATTTCNAATCGCGATGATCATCCCCTCTCTAGAGGAGCTGGACTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl