Prev. |  KEGG KO K14777 > 

RIKEN DNA Bank Human Resource - DDX47

Gene ID NCBI Gene 51202 |  KEGG hsa:51202
Gene Symbol DDX47
Protein Name DEAD-box helicase 47
Synonyms E4-DBP|HQ0256|MSTP162|RRP3
Ortholog resource in our bank

  DDX47

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056212 IRAK140I20 pCMV-SPORT6 BC068009 NM_016355 Full
HGY090527 IRAL026F07 pOTB7 BC009379 NM_016355 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018564 W01A046G20 pENTR-TOPO flj0001k03 AK054574 NM_016355  
HGE018568 W01A046G24 pENTR-TOPO flj0001k03 AK054574 NM_016355  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050905 ARe27E09 pKA1U5 NM_016355.3  
GAGGTCTAGAGTTTATCTTCCTAAACAGTCGTGATATCATTGGGCTTGCAGAAACTGGCT
HKR057724 ARe44F04 pKA1U5 NM_016355.3  
TGGCACTTCCGGAGACCTCACACAAGATGGCGGCACCNGAGGAACACGATTCTCCGACCG
HKR260254 ARiS150K14 pGCAP10 NM_016355.3  
GCTCACACAAGATGGCGGCACCCGAGGAACACGATTCTCCGACCGAAGCGTCCCAGCCGA
HKR260300 ARiS150M12 pGCAP10 NM_016355.3  
GCTCACACAAGATGGCGGCACCCGAGGAACACGATTCTCCGACCGAAGCGTCCCAGCCGA
HKR260353 ARiS150O17 pGCAP10 NM_016355.3  
GCTCACACANNATGGCGGCNCCCGAGGAACACGATTCTCCGACCGAAGCGTCCCAGCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl