Prev. |  KEGG KO K20028 > 

RIKEN DNA Bank Human Resource - ZDHHC2

Gene ID NCBI Gene 51201 |  KEGG hsa:51201
Gene Symbol ZDHHC2
Protein Name zinc finger DHHC-type palmitoyltransferase 2
Synonyms DHHC2|ZNF372
Ortholog resource in our bank

  ZDHHC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010881 IRAK027D09 pCMV-SPORT6 BC050272 NM_016353 Full
HGY019515 IRAK048N03 pBluescriptR BC039253 NM_016353 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001482 W01A003L18 pENTR-TOPO IRAK048N03 BC039253 NM_016353  
HGE001484 W01A003L20 pENTR-TOPO IRAK048N03 BC039253 NM_016353  
HGE001486 W01A003L22 pENTR-TOPO IRAK048N03 BC039253 NM_016353  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056849 ARe42C01 pKA1U5 NM_016353.4  
GGCCTCCTCGGCCTCCGCTCGCAGCCGCCGCCTCCGCCTCCGCCGGGCTGAGGAGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl