Prev. |  KEGG KO K11793 > 

RIKEN DNA Bank Human Resource - CRBN

Gene ID NCBI Gene 51185 |  KEGG hsa:51185
Gene Symbol CRBN
Protein Name cereblon
Synonyms MRT2|MRT2A
Ortholog resources KEGG ortholog (KEGG orthology K11793) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067088 IRAK167L24 pBluescriptR BC067811 NM_016302 Full/var
HGY095408 IRAL038I16 pDNR-LIB BC017419 NM_016302 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR420647 RBdS051K07 pGCAP10 NM_016302.2  
GAGACATGGCCGGCGAAGGAGATCAGCAGGACGCTGCGCACAACATGGGCAACCACCTGC
HKR430098 RBdS075E02 pGCAP10 NM_016302.2  
GAGACATGGCCGGCGAAGGAGATCAGCAGGACGCTGCGCACAACATGGGCAACCACCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl