Prev. | 

RIKEN DNA Bank Human Resource - HSPA14

Gene ID NCBI Gene 51182 |  KEGG hsa:51182
Gene Symbol HSPA14
Protein Name heat shock protein family A (Hsp70) member 14
Synonyms HSP70-4|HSP70L1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011137 IRAK027O01 pCMV-SPORT6 BC026226 NM_016299 Partial/var
HGX056365 IRAK140P05 pCMV-SPORT6 BC065281 NM_001037538 Full
HGY093563 IRAL033P03 pOTB7 BC015696 NM_016299 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084433 M01C011B09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084481 M01C011D09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084529 M01C011F09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084577 M01C011H09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084625 M01C011J09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084673 M01C011L09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084721 M01C011N09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  
HGE084769 M01C011P09 pDONR221 FLJ03-C05 AK000880 ENST00000378348  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR013775 ARa34H07 pKA1U5 NM_016299.2  
GGTGAAGCTCCGCGGTGCCTGATGGGGCCGTTGGGCGGCCGGTAGCTGTTGCTGTTGGGG
HKR405657 RBdS014C09 pGCAP10 NM_016299.2  
GGGCGGGAACGTGAAGCTCCGCGGTGCCTGATGGGGCCGTTGGGCGGCCGGTAGCTGTTG
HKR444263 RBdS110K23 pGCAP10 NM_016299.2  
GGGTGCCTGATGGGGCCGTTGGGCGGCCGGTAGCTGTTGCTGTTGGGGGACCCCCTCATT
HKR453005 RBdS132I13 pGCAP10 NM_016299.2  
GGCGGTGCCTGATGGGGCCGTTGGGCGGCCGGTAGCTGTTGCTGTTGGGGGACCCCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl