DNA Bank Top |  KEGG KO K03331 > 

RIKEN DNA Bank Human Resource - DCXR

Gene ID NCBI Gene 51181 |  KEGG hsa:51181
Gene Symbol DCXR
Protein Name dicarbonyl and L-xylulose reductase
Synonyms DCR|HCR2|HCRII|KIDCR|P34H|PNTSU|SDR20C1|XR

Link

Ortholog resource in our bank

  DCXR


External database

human DCXR

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07762 pcDNA3.1(+)-human DCXR Expression vector of human DCXR.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081927 IRAL004N15 pOTB7 BC001470 NM_016286 Full
HGY083693 IRAL009D21 pOTB7 BC003018 NM_016286 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218113 ARiS045E17 pGCAP10 NM_016286.2  
HKR328556 RBb21G12 pKA1U5 NM_016286.2  
GGGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCGGGTGCTGGTCACCGGGGC
HKR335770 RBb39H02 pGCAP1 NM_016286.2  
GGGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCNGGATGCTGGTCACCGGGG
HKR346826 RBb67B02 pGCAP1 NM_016286.2  
GGGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCGGGTGCTGGTCACCGGGGC
HKR388855 RBd72C07 pGCAP10 NM_016286.2  
GCTCTCGGGGCTGGTGGCCTGCGTGGGCGGCCGGGTGGTCGGCAGAGCCGCCGGGGCCCC
HKR398952 RBd97G08 pGCAP10 NM_016286.2  
GGGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCGGGTGCTGGTCACCGGGGC
HKR405245 RBdS013B21 pGCAP10 NM_016286.2  
GGGAGACTGCGCCGACATGGAGCTGTTCCTCGCGGGCCGCCGGGTGCTGGTCACCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl