Prev. |  KEGG KO K12184 > 

RIKEN DNA Bank Human Resource - VPS28

Gene ID NCBI Gene 51160 |  KEGG hsa:51160
Gene Symbol VPS28
Protein Name VPS28 subunit of ESCRT-I
Synonyms -
Featured content Endocytosis (human)
Ortholog resource in our bank

  VPS28

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039380 IRAK098H12 pCMV-SPORT6 BC050438 NM_183057 Partial/var
HGX044056 IRAK110C08 pCMV-SPORT6 BC050712 NM_183057 Partial/var
HGX044127 IRAK110F07 pCMV-SPORT6 BC050713 NM_183057 Full
HGY083373 IRAL008H05 pOTB7 BC006485 NM_016208 Full
HGY083695 IRAL009D23 pOTB7 BC019321 NM_016208 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068175 ARe70H07 pKA1U5 NM_016208.2  
GGCCCCCGGCGCCATCTTCCCGACCGCGAGCCGCCCTNGATCTCAGTGCTGTGCCCCCCC
HKR162456 ARi06C08 pGCAP10 NM_016208.2  
GGGCGCCATCTTCCCGACCGCGAGCCGTCCAGGGTCTTGCTCTGTCTCCCAGGCTGGAGT
HKR170077 ARi25D05 pGCAP10 NM_016208.2  
GGCACCCCGCCCCCGGCGCCATCTTCCCGACCGCGAGCCGTCCAGGTCTCAGTGCTGTGC
HKR205253 ARiS013C05 pGCAP10 NM_016208.2  
GGCACCCCNCCCCCNNCGCCATCTTCCCGACCGCGAGCCGTCCAGGTCTCAGTGCTGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl