Prev. |  KEGG KO K10251 > 

RIKEN DNA Bank Human Resource - HSD17B12

Gene ID NCBI Gene 51144 |  KEGG hsa:51144
Gene Symbol HSD17B12
Protein Name hydroxysteroid 17-beta dehydrogenase 12
Synonyms KAR|SDR12C1
Ortholog resource in our bank

  HSD17B12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085202 IRAL013A02 pOTB7 BC012043 NM_016142 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179300 ARi48E04 pGCAP10 NM_016142.2  
TGATTCACGAAGGTAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCG
HKR180050 ARi50C02 pGCAP10 NM_016142.2  
TGGAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTAC
HKR260289 ARiS150M01 pGCAP10 NM_016142.2  
GGGGCGGGGTTTAGGCCCAAAGTGNTGTCGGANCAGCGCCTATTAGTGTCATCCTCACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl