Prev. |  KEGG KO K10416 > 

RIKEN DNA Bank Human Resource - DYNC1LI1

Gene ID NCBI Gene 51143 |  KEGG hsa:51143
Gene Symbol DYNC1LI1
Protein Name dynein cytoplasmic 1 light intermediate chain 1
Synonyms DLC-A|DNCLI1|LIC1
Ortholog resource in our bank

  DYNC1LI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR189684 ARi74D12 pGCAP10 NM_016141.2  
GAGTCTTGCCGGGAGTGGTGTGATTCCCGACCAAGATGGCGGCCGTGGGGCGAGTCGGCT
HKR433205 RBdS083A05 pGCAP10 NM_016141.2  
GACAAAGAGAGCCAGCGAGCTAGCCCGCGGACCAGGTACCCCGGGCCGCTGGGGGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl