Prev. | 

RIKEN DNA Bank Human Resource - INSIG2

Gene ID NCBI Gene 51141 |  KEGG hsa:51141
Gene Symbol INSIG2
Protein Name insulin induced gene 2
Synonyms INSIG-2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY012877 IRAK032D05 pBluescriptR BC022475 NM_016133 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089215 M01C023A15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089263 M01C023C15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089311 M01C023E15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089359 M01C023G15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089407 M01C023I15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089455 M01C023K15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089503 M01C023M15 pDONR221 MGC01-A08 BC022475 ENST00000340599  
HGE089551 M01C023O15 pDONR221 MGC01-A08 BC022475 ENST00000340599  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE011019 W01A027J03 pENTR-TOPO IRAK032D05 BC022475 NM_016133  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053770 ARe34H02 pKA1U5 NM_016133.2  
GAGTTGGGGGTCTCCCGGCGAAGCGCGGGTGACNCTGTTTGCTGAGGAAAGCGGCCTGAG
HKR076433 ARe91B09 pKA1U5 NM_016133.2  
GGGGGGCTGGTCCCAGAAGATGGCGGAGGCGGGGGATTTCTGGTAGGTCCTACTTTAGGA
HKR249056 ARiS122K16 pGCAP10 NM_016133.2  
GGTTNTGNGAGTGGAGGANGAAGAGGCGGTAGGGGGTACGGGNGCNNGNNNANAAGATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl