Prev. |  KEGG KO K16754 > 

RIKEN DNA Bank Human Resource - CEP83

Gene ID NCBI Gene 51134 |  KEGG hsa:51134
Gene Symbol CEP83
Protein Name centrosomal protein 83
Synonyms CCDC41|NPHP18|NY-REN-58
Ortholog resource in our bank

  CEP83

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR471147 RBdS177O11 pGCAP10 NM_001042399.1 done
GGGCGCCGCACCCCTGAGGATCCCGGTCCACGCGGAGGAGTGGGGCTTTTCACCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl