Prev. |  KEGG KO K10325 > 

RIKEN DNA Bank Human Resource - ASB3

Gene ID NCBI Gene 51130 |  KEGG hsa:51130
Gene Symbol ASB3
Protein Name ankyrin repeat and SOCS box containing 3
Synonyms ASB-3
Ortholog resource in our bank

  ASB3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083527 IRAL008N15 pOTB7 BC006488 NM_016115 Full
HGY086730 IRAL016N18 pDNR-LIB BC009569 NM_016115 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020305 W01A050M17 pENTR-TOPO IRAL016N18 BC009569 NM_016115  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364851 RBd12C03 pGCAP10 NM_016115.3  
GAGCTCTGGAGACGCGGCCTCGGACCAGCCATTTCGGTGTAGAAGTGGCAGCACGGCAGA
HKR372532 RBd31F12 pGCAP10 NM_016115.3  
GGAGACGCGGCCTCGGACCAGCCATTTCGGTGTAGAAGTGGCAGCACGGCAGACTGGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl