Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ANGPTL4

Gene ID (NCBI) 51129
Gene Symbol ANGPTL4
Protein Name angiopoietin-like 4
Synonyms ANGPTL2|ARP4|FIAF|HARP|HFARP|NL2|PGAR|UNQ171|pp1158
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08767)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03992 pCAhANGPTL4 Expression vector of human angiopoietin-like 4

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY095951 IRAL039O15 pOTB7 BC023647 NM_139314 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074570 ARe86H02 pKA1U5 NM_139314.1  
GGAAGCCGAGCTGAGCGGATCCTCACATGACTGTGATCCGATTCTTTCCAGCGGCTTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl