Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAA20

Gene ID (NCBI) 51126
Gene Symbol NAA20
Protein Name N(alpha)-acetyltransferase 20, NatB catalytic subunit
Synonyms NAT3|NAT3P|NAT5|NAT5P|dJ1002M8.1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17972)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086552 IRAL016G08 pDNR-LIB BC005181 NM_016100 Full
HGY088531 IRAL021F11 pDNR-LIB BC008446 NM_016100 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075209 ARe88A09 pKA1U5 NM_016100.3  
TGGGGAGACTTCCGGCAGGGCGGGCGCGGGGTCTTGGCGAACGGTCTTCGGAAGCGGCGG
HKR219790 ARiS049H22 pGCAP10 NM_016100.3  
GGGGAGACTTCCGGCAGGGCGGGCGCGGGGTCTTGGCGAACGGTCTTCGGAAGCGGCGGC
HKR360952 RBd02G08 pGCAP10 NM_016100.3  
GGGAAGCGGCGGCGGCGCGATGACCACGCTACGGGCCTTTACCTGCGACGACCTGTTCCG
HKR453085 RBdS132L21 pGCAP10 NM_016100.3  
GGGGAGACTTCCGGCAGGGCGGGCGCGGGGTCTTGGCGAACGGTCTTCGGAAGCGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl