Prev. | 

RIKEN DNA Bank Human Resource - GOLGA7

Gene ID NCBI Gene 51125 |  KEGG hsa:51125
Gene Symbol GOLGA7
Protein Name golgin A7
Synonyms GCP16|GOLGA3AP1|GOLGA7A|HSPC041
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001833 IRAK004J17 pCMV-SPORT6 BC001227 NM_016099 Full/var
HGX011480 IRAK028L16 pCMV-SPORT6 BC012032 NM_016099 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163750 ARi09G06 pGCAP10 NM_016099.2  
GGGGTGAGGCGCTGAGACGGTTTGGCGGTGAGTCCTGGGCCAGGCGCAGCTGAAAGGCCC
HKR341721 RBb54F01 pGCAP1 NM_016099.2  
GGCGGTGCGACAGCAGCTGGAGGGCAGAGGAGGCGGCGCGGGGTGTCCTGTCCTCGCCAT
HKR406013 RBdS015A13 pGCAP10 NM_016099.2  
TGAAGGCGGTGCGACAGCAGCTGGAGGGCAGAGGAGGCGGCGCGGGGTGTCCTGTCCTCG
HKR428267 RBdS070L03 pGCAP10 NM_016099.2  
GGGCGGTGCGACAGCAGCTGGAGGGCAGAGGAGGCGGGTTTGTGTTTCCCGGGCCGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.29

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl