Prev. | 

RIKEN DNA Bank Human Resource - COMMD2

Gene ID NCBI Gene 51122 |  KEGG hsa:51122
Gene Symbol COMMD2
Protein Name COMM domain containing 2
Synonyms HSPC042
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042835 IRAK107B11 pCMV-SPORT6 BC046131 NM_016094 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167301 ARi18E05 pGCAP10 NM_016094.2  
GGAAGGCGGGGTCGGCGCTGCCGGGTGAAATCGTAGGACAGTGAAGATGCTGCTGGAATT
HKR209577 ARiS023P17 pGCAP10 NM_016094.2  
GGGCGAAGGCGGGGTCGGCGCTGCCGGGTGAAATCGTAGGACAGTGAAGATGCTGCTGGA
HKR396500 RBd91E04 pGCAP10 NM_016094.2  
GGGGTGAAATCGTAGGACAGTGAAGATGCTGCTGGAATTGTCCGAGGAGCATAAGGAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl