Prev. |  KEGG KO K14574 > 

RIKEN DNA Bank Human Resource - SBDS

Gene ID NCBI Gene 51119 |  KEGG hsa:51119
Gene Symbol SBDS
Protein Name SBDS ribosome maturation factor
Synonyms CGI-97|SDS|SWDS
Ortholog resource in our bank

  SBDS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056560 IRAK141G16 pCMV-SPORT6 BC065700 NM_016038 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205567 ARiS013P07 pGCAP10 NM_016038.2  
GGCCAGACACACTGTGACGGCTGCCTGAAGCTAGTGAGTCGCGGCGCCGCGCACTGGTGG
HKR249095 ARiS122M07 pGCAP10 NM_016038.2  
GGCTCACTTTTCCCCTCCCGGCTTCTGCTCCACCTGACGCCTGCGCAGTAAGTAAGCCTG
HKR366178 RBd15H10 pGCAP10 NM_016038.2  
GGCCAGACACGCTGTGGCGGCTGCCTGAAGCTAGTGAGTCGCGGCGCCGCGCACTTGTGG
HKR373348 RBd33G04 pGCAP10 NM_016038.2  
TGGCGGAGACACACTGTGACGGCTGCCTGAAGCTAGTGAGTCGCGGCGCCGCGCACTGGT
HKR408982 RBdS022H14 pGCAP10 NM_016038.2  
GGCCAGACACACTGTGACGGCTGCCTGAAGCTAGTGAGTCGCGGCGCCGCGCACTGGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl