Prev. | 

RIKEN DNA Bank Human Resource - METTL9

Gene ID NCBI Gene 51108 |  KEGG hsa:51108
Gene Symbol METTL9
Protein Name methyltransferase like 9
Synonyms CGI-81|DREV|DREV1|PAP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082641 IRAL006K01 pOTB7 BC000195 NM_016025 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR323297 RBb08E01 pKA1U5 NM_016025.3  
GCTTTTTTGCCCTGAAGGGGGCTGGATGGGCAAGGCGGCCGCGATGGCTCGAGCTCGGGC
HKR390856 RBd77C08 pGCAP10 NM_016025.3  
GGCCCTGAAGGGGGCTGGATGGGCAAGGCGGCCGCGATGGCTCGAGCTCGGGCGGTGGCG
HKR394102 RBd85E06 pGCAP10 NM_016025.3  
GTTTTGCCCTGAAGGGGGCTGGATGGGCAAGGCGGCCGCGATGGCTCGAGCTCGGGCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl