Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - APH1A

Gene ID (NCBI) 51107
Gene Symbol APH1A
Protein Name APH1A gamma secretase subunit
Synonyms 6530402N02Rik|APH-1|APH-1A|CGI-78
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Notch signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06172)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011049 IRAK027K09 pCMV-SPORT6 BC020590 NM_016022 Partial/var
HGX001938 IRAK004O02 pCMV-SPORT6 BC001230 NM_016022 Partial/var
HGX008094 IRAK020D22 pCMV-SPORT6 BC017699 NM_016022 Full/var
HGY082291 IRAL005M03 pOTB7 BC008732 NM_016022 Full/var
HGY090320 IRAL025N08 pOTB7 BC009501 NM_016022 Full/var
HGY093203 IRAL033A03 pOTB7 BC015568 NM_016022 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010075 W01A025D03 pENTR-TOPO X01Y103E15 BC020590 NM_016022  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044402 ARe11A02 pKA1U5 NM_016022.2  
GCCCCCTTCCCCATTCCCCGGGGTCTGGGGGTGACATTGCACCGCGCCCCTCGNTGGGGT
HKR076481 ARe91D09 pKA1U5 NM_016022.2  
GGTAGAGGAAGTGGCGCGGACCTTCATTTGGGGTTTCGGTTCCCCCCCTTCCCCTTCCCC
HKR326552 RBb16G08 pKA1U5 NM_016022.2  
GCCCCCCCTTCCCCTTCCCCGGGGTCTGGGGGTGACATTGCACCGCGCCCCTCGTGGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl