Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SH3GLB1

Gene ID (NCBI) 51100
Gene Symbol SH3GLB1
Protein Name SH3-domain GRB2-like endophilin B1
Synonyms Bif-1|PPP1R70|dJ612B15.2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11248)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081250 IRAL003C02 pOTB7 BC007455 NM_016009 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042802 ARe07A02 pKA1U5 NM_016009.3  
GGCCCCAGCCCGGCCGCGGCACCTCCGCCTCGCCGCCGCTAGGTCGGCCGGCTCCGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl