Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABHD5

Gene ID (NCBI) 51099
Gene Symbol ABHD5
Protein Name abhydrolase domain containing 5
Synonyms CDS|CGI58|IECN2|NCIE2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13699)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006307 IRAK015M19 pCMV-SPORT6 BC021958 NM_016006 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049606 ARe24A06 pKA1U5 NM_016006.3  
GGGCCTGCGCCGCCTTAAGTGCCGCGCCAGCCCGGGGCGGCCCAGTCGGCCTGTCAGCCG
HKR222132 ARiS055F12 pGCAP10 NM_016006.3  
GCCCAGTCGGCCTGTCAGCCGGCTTCGAGATAAGTCCCGGCGCTTGCGCGGCGGCGGCTA
HKR234057 ARiS085C09 pGCAP10 NM_016006.3  
GAGTCGGCCTGTCAGCCGGCTTCGAGATAAGTCCCGGCGCTTGCGCGGCGGCGGCTATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl