Prev. |  KEGG KO K13699 > 

RIKEN DNA Bank Human Resource - ABHD5

Gene ID NCBI Gene 51099 |  KEGG hsa:51099
Gene Symbol ABHD5
Protein Name abhydrolase domain containing 5
Synonyms CDS|CGI58|IECN2|NCIE2
Ortholog resources KEGG ortholog (KEGG orthology K13699) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006307 IRAK015M19 pCMV-SPORT6 BC021958 NM_016006 This clone has been withdrawn

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049606 ARe24A06 pKA1U5 NM_016006.3  
GGGCCTGCGCCGCCTTAAGTGCCGCGCCAGCCCGGGGCGGCCCAGTCGGCCTGTCAGCCG
HKR222132 ARiS055F12 pGCAP10 NM_016006.3  
GCCCAGTCGGCCTGTCAGCCGGCTTCGAGATAAGTCCCGGCGCTTGCGCGGCGGCGGCTA
HKR234057 ARiS085C09 pGCAP10 NM_016006.3  
GAGTCGGCCTGTCAGCCGGCTTCGAGATAAGTCCCGGCGCTTGCGCGGCGGCGGCTATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.10.03

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl