Prev. |  KEGG KO K10442 > 

RIKEN DNA Bank Human Resource - KLHL5

Gene ID NCBI Gene 51088 |  KEGG hsa:51088
Gene Symbol KLHL5
Protein Name kelch like family member 5
Synonyms -
Ortholog resource in our bank

  KLHL5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037560 IRAK093O24 pCMV-SPORT6 BC048262 NM_199039 Partial
HGX046327 IRAK115N15 pCMV-SPORT6 BC053860 NM_001007075 Full
HGX047975 IRAK119P15 pCMV-SPORT6 BC058884 NM_199039 Partial
HGX066774 IRAK166P14 pCMV-SPORT6 BC081562 NM_199039 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164426 ARi11B02 pGCAP10 NM_001007075.1 done
GGGCGCCGCCTGACGGAGCGGGAGTGGCTCGCTCCGGGCCGGCCGGCGCCGGGGATGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl