Prev. |  KEGG KO K01619 > 

RIKEN DNA Bank Human Resource - DERA

Gene ID NCBI Gene 51071 |  KEGG hsa:51071
Gene Symbol DERA
Protein Name deoxyribose-phosphate aldolase
Synonyms CGI-26|DEOC
Ortholog resource in our bank

  DERA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099264 IRAL048C16 pDNR-LIB BC056234 NM_015954 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279577 ARiS198P17 pGCAP10 NM_015954.2  
GGCGGCGCAGAGGCGGGCGCCTACCAGCCGGCAGCTCCGGAGCTGCCCGCGCCATGTCCG
HKR368105 RBd20E09 pGCAP10 NM_015954.2  
CGGCCGGCCGATATGGCGGCGCAGAGGCGGGCGCCTACCAGCCGGCAGCTCCGGAGCTGC
HKR369605 RBd24A05 pGCAP10 NM_015954.2  
GGAGGCGGGCGCCTACCAGCCGGCAGCTCCGGAGCTGCCCGCGCCATGTCCGCGCACAAT
HKR371625 RBd29B01 pGCAP10 NM_015954.2  
GGGGGCGAGCGCTCCAGCTGGCGGGAAGGAGGAAGGGCCGGGCGCGGCGCAGAGGCGGGC
HKR397632 RBd94B08 pGCAP10 NM_015954.2  
GGCCTACCAGCCGGCAGCTCCGGAGCTGCCCGCGCCATGTCCGCGCACAATCGGGGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl