Prev. |  KEGG KO K02886 > 

RIKEN DNA Bank Human Resource - MRPL2

Gene ID NCBI Gene 51069 |  KEGG hsa:51069
Gene Symbol MRPL2
Protein Name mitochondrial ribosomal protein L2
Synonyms CGI-22|MRP-L14|RPML14
Ortholog resource in our bank

  MRPL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008555 IRAK021G11 pCMV-SPORT6 BC013685 NM_015950 Full
HGY096151 IRAL040G07 pOTB7 BC020212 NM_015950 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR342482 RBb56D10 pGCAP1 NM_015950.3  
AAGTTAAGGGTGTCGCTGCTGATGGCCCTGNTGCGCACATGACCCGCGCTCTGCGCTCTC
HKR345770 RBb64H02 pGCAP1 NM_015950.3  
GACCGAGCAGCTTGGCTAAAAGTAAGGGTGTCGTGCTGATGGCCCTGTGCGCACTGACCC
HKR376953 RBd42G09 pGCAP10 NM_015950.3  
TGGTCGTGCTGATGGCCCTGTGCGCACTGACCCGCGCTCTGCGCTCTCTGAACCTGGCGC
HKR382980 RBd57H12 pGCAP10 NM_015950.3  
GGGCTAAAAGTAAGGGTGTCGTGCTGATGGCCCTGTGCGCACTGNNCCGCGCTCTGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl