Prev. |  KEGG KO K02978 > 

RIKEN DNA Bank Human Resource - RPS27L

Gene ID NCBI Gene 51065 |  KEGG hsa:51065
Gene Symbol RPS27L
Protein Name ribosomal protein S27 like
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K02978) in the DNA Bank
Featured content SARS-CoV-2 relevant human genes
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030107 IRAK075E11 pBluescriptR BC031307 NM_015920 Partial
HGY086705 IRAL016M17 pDNR-LIB BC003667 NM_015920 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105221 M01C063A21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105269 M01C063C21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105317 M01C063E21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105365 M01C063G21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105413 M01C063I21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105461 M01C063K21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105509 M01C063M21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE105557 M01C063O21 pDONR221 06_06-A11 AK024591 NM_015920  
HGE082820 M01C007A20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE082868 M01C007C20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE082916 M01C007E20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE082964 M01C007G20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE083012 M01C007I20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE083060 M01C007K20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE083108 M01C007M20 pDONR221 FLJ01-B10 AK024591 NM_015920  
HGE083156 M01C007O20 pDONR221 FLJ01-B10 AK024591 NM_015920  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041769 ARe04H01 pKA1U5 NM_015920.3  
GGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCNACATGCCTTTGGCTAGAGATTTA
HKR044058 ARe10C10 pKA1U5 NM_015920.3  
AGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAA
HKR046480 ARe16D08 pKA1U5 NM_015920.3  
GGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR046980 ARe17H12 pKA1U5 NM_015920.3  
GGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTAGAGATTTACT
HKR048174 ARe20H06 pKA1U5 NM_015920.3  
AGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAA
HKR048921 ARe22F01 pKA1U5 NM_015920.3  
GAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCA
HKR051779 ARe29H11 pKA1U5 NM_015920.3  
GGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR060578 ARe51H10 pKA1U5 NM_015920.3  
GGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCT
HKR062810 ARe57A10 pKA1U5 NM_015920.3  
GAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAAC
HKR064130 ARe60F10 pKA1U5 NM_015920.3  
GAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCA
HKR078500 ARe96E04 pKA1U5 NM_015920.3  
TTTTGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTAGAGATT
HKR081275 ARf03D03 pKA1U5 NM_015920.3  
GGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCT
HKR081376 ARf03H08 pKA1U5 NM_015920.3  
GGATGCCNAGCGCAGATCNCTTGCANCTTGCCTAGCCTGCTGGTGGGCTGCGGTAGGTCT
HKR160505 ARi01E09 pGCAP10 NM_015920.3  
GGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCA
HKR161629 ARi04B05 pGCAP10 NM_015920.3  
TTGGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCT
HKR162578 ARi06H10 pGCAP10 NM_015920.3  
NGGAAGTTGATGCCGAGCGCAGATTCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGT
HKR164978 ARi12H10 pGCAP10 NM_015920.3  
GGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR175352 ARi38G08 pGCAP10 NM_015920.3  
AGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAA
HKR180098 ARi50E02 pGCAP10 NM_015920.3  
GTGTGGGCTGGGAGGTCTGGTANGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTA
HKR182953 ARi57G09 pGCAP10 NM_015920.3  
GGATGCCCAGCGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGG
HKR185304 ARi63E08 pGCAP10 NM_015920.3  
CGGCCGGCCGATGGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTA
HKR203536 ARiS008N24 pGCAP10 NM_015920.3  
GAGGGCTGAGCTTGCAAGAGGATCAACATGCCTTTGGCTAGAGATTTACTACATCCGTCC
HKR277776 ARiS194H08 pGCAP10 NM_015920.3  
TGAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGGATCAACATGCCTT
HKR345659 RBb64C11 pGCAP1 NM_015920.3  
GGTAGCTTATGAGCGGTCTTGGTCTTTGAGGATGCCCCTGAGTTGGCTAGAGATTTACTA
HKR361284 RBd03D12 pGCAP10 NM_015920.3  
GGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR366950 RBd17G06 pGCAP10 NM_015920.3  
GAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCA
HKR378556 RBd46G12 pGCAP10 NM_015920.3  
TTTAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR384155 RBd60G11 pGCAP10 NM_015920.3  
GAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCA
HKR384432 RBd61B08 pGCAP10 NM_015920.3  
GGCGCACCGGGGGCAACCCGATCACTATGGAGGCCGGGNNGACTGGTAGGGCTGGGCCGA
HKR389702 RBd74E06 pGCAP10 NM_015920.3  
GGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCAAGAGG
HKR391659 RBd79C11 pGCAP10 NM_015920.3  
GGCAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTG
HKR406094 RBdS015D22 pGCAP10 NM_015920.3  
GAGATCGCTTGCAGCTTGCTAGCTGTGTGGGCTGGGAGGTCTGGTAGGGCTGAGCTTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl