Prev. |  KEGG KO K11142 > 

RIKEN DNA Bank Human Resource - LAP3

Gene ID NCBI Gene 51056 |  KEGG hsa:51056
Gene Symbol LAP3
Protein Name leucine aminopeptidase 3
Synonyms HEL-S-106|LAP|LAPEP|PEPS
Ortholog resource in our bank

  LAP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056240 IRAK140J24 pCMV-SPORT6 BC065564 NM_015907 Full
HGY081159 IRAL002O23 pOTB7 BC006199 NM_015907 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096038 M01C040B14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096086 M01C040D14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096134 M01C040F14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096182 M01C040H14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096230 M01C040J14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096278 M01C040L14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096326 M01C040N14 pDONR221 MGC09-H07 BC065564 NM_015907  
HGE096374 M01C040P14 pDONR221 MGC09-H07 BC065564 NM_015907  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065322 ARe63F02 pKA1U5 NM_015907.2  
GAGTCGTCCGACGTCTGGCCGTGAGACGTTTCGGGAGCCGGAGTCTCTCCACCGCAGACA
HKR170454 ARi26C06 pGCAP10 NM_015907.2  
GGCCCAGCGTTAGCCCGCGGCCAGGCAGCCGGGAGGAGCGGCGCGCGCTCGGACCTCTCC
HKR222015 ARiS055A15 pGCAP10 NM_015907.2  
GGCGAGTAGTCGTCCGACGTCTGGCCGTGAGACGTTTCGGGAGCCGGAGTCTCTCCACCG
HKR337251 RBb43C03 pGCAP1 NM_015907.2  
HKR364480 RBd11D08 pGCAP10 NM_015907.2  
GCTTGCTGCCTCTTCCGGCTGCGGGGCGAGTAGTCCTCCGACGTCTGGCCGTGAGACGTT
HKR387754 RBd69G10 pGCAP10 NM_015907.2  
GAGCCCGCGGCCAGGCAGCCGGGAGGAGCGGCGCGCGCTCGGACCTCTCCCGCCCTGCTC
HKR390971 RBd77H03 pGCAP10 NM_015907.2  
GAGTCGTCCGACGTCTGGCCGTGAGACGTTTCGGGAGCCGGAGTCTCTCCACCGCAGACA
HKR398955 RBd97G11 pGCAP10 NM_015907.2  
GGCTGCCTCTTCCGGCTGCGGGGCGAGTAGTCGTCCGACGTCTGGCCGTGAGACGTTTCG
HKR398976 RBd97H08 pGCAP10 NM_015907.2  
GAGGCCCAGCGTTAGCCCGCGGCCAGGCAGCCGGGAGGAGCGGCGCGCGCTCGGACCTCT
HKR406163 RBdS015G19 pGCAP10 NM_015907.2  
GGAGTAGTCGTCCGACGTCTGGCCGTGAGACGTTTCGGGAGCCGGAGTCTCTCCACCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl